Open Access

Interleukin-23 may contribute to the pathogenesis of lumbar disc herniation through the IL-23/IL-17 pathway

  • Hongqiang Jiang1,
  • Yao Deng2,
  • Tao Wang2,
  • Jianxiong Ma2,
  • Pengfei Li2,
  • Peng Tian2,
  • Chao Han2 and
  • Xinlong Ma1, 2Email author
Contributed equally
Journal of Orthopaedic Surgery and Research201611:12

https://doi.org/10.1186/s13018-016-0343-8

Received: 30 October 2015

Accepted: 7 January 2016

Published: 16 January 2016

Abstract

Background

Studies have indicated that interleukin 23 (IL-23) plays an important role in many inflammatory- and autoimmune-related diseases. However, there is little knowledge about IL-23 in lumbar disc herniation (LDH). Thus, in this study, we aimed to find out whether IL-23 is expressed in intervertebral discs (IVDs) and what roles it may play.

Methods

Human IVD tissues were collected from 29 LDH patients and 8 vertebral fracture patients (normal control, NC group). According to the integrity of annulus fibrosus, LDH patients were divided into two groups: R group (ruptured group, n = 16) and NR group (non-ruptured group, n = 13). Morphological changes of IVDs were assessed by hematoxylin and eosin (HE staining), and expression of IL-23 in IVD tissues was detected by immunohistochemical staining. Besides gene expression of IL-23, IL-17, IL-6, IL-1β, and TNF-α was also evaluated by reverse transcription polymerase chain reaction (RT-PCR).

Results

The results showed that the R group was more degenerated than the other two groups and NC group showed the least degenerated performance; stronger positive IL-23 expression was observed in herniated IVDs, especially in the R group. Meanwhile, higher gene expression of IL-23, IL-17, IL-6, IL-1β, and TNF-α was found in the tissues from LDH patients and a positive correlation between IL-17 and IL-23 gene expression was also observed.

Conclusions

Taken all above results together, it may be deduced that higher expression of IL-23 may contribute to the deterioration of IVDs through the IL-23/IL-17 pathway.

Keywords

Lumbar disc herniationIntervertebral discIL-23IL-17

Background

Lumbosacral radiculopathy is a common and costly health problem, which often occurs as a result of mechanical compression and biochemical irritation on the nerve root by lumbar disc herniation (LDH) [1]. Although mechanical deformation may contribute to the radicular pain, it is currently believed that autoimmune reaction and related inflammatory mediators are the key players in causing this symptom. Nucleus pulposus (NP) was believed to be an autoantigen; this is supported by accumulation of lymphocytes in local disc tissues following exposure to autologous NP or injury to the annulus fibrosus [2]. some animal studies proved that inflammatory and immune response could be induced by a healthy autologous NP which was applied to nerve root, as a model of non-compressive disc herniation, resulting in neuronoglial apoptosis, a decrease in nerve conduction velocity, the onset of gait abnormality, mechanical allodynia and thermal hyperalgesia [39]. Inflammatory cells (mainly macrophages) from the intervertebral disc (IVD) tissues can secrete many pro-inflammatory mediators and regulatory cytokines, such as prostaglandin E2 [1012], TNF-α [1318], IL-1β [13, 14], IL-6 [13, 19], IL-8 [20], IL-12 [19, 21], nerve growth factor [22], vascular endothelial growth factor [23], and substance P [22, 24].

Interleukin 23 (IL-23) is a heterodimeric pro-inflammatory cytokine, which is mainly secreted by activated macrophages. It can help Th17 cells to expand and maintain their lineage [25, 26], meanwhile promoting the production of IL-17 without the engagement of T cell receptor in γσT cells [27]. Thus, both IL-23 and IL-17 form a new axis through Th17 cells, which play an important role in many autoimmunity and chronic inflammation diseases, such as experimental autoimmune encephalomyelitis, rheumatoid arthritis, and inflammatory bowel disease [2830], and targeting on them has become a new strategy for these kind of diseases as some exciting news have been reported in several articles [31, 32].

Recently, studies have proven that Th17 cells and IL-17 was infiltrated and expressed in IVD tissues and may contribute a lot to the local inflammation and radicular pain [3336]. Take into consideration that macrophages are the predominantly infiltrated cells in herniated discs and can secrete IL-23 when they are activated, we may speculate that IL-23/Th17/IL-17 axis may still have a contribution to the pathogenesis of LDH. However, there is little knowledge about IL-23 in LDH up to now. Thus, the current study was carried out to investigate whether IL-23 was expressed in IVD tissues and whether IL-23/IL-17 pathway plays a role in the pathogenesis of LDH.

Methods

Source of human IVD tissues

From August 2014 to January 2015, 29 patients diagnosed with LDH were randomly recruited from the Spine Department of Tianjin Hospital. The enrolled patients should meet all the following criteria: (1) typical osphyalgia or sciatica symptoms, (2) positive Lasegue’s sign or Bragard test, (3) single lumbar disc herniation, and (4) symptoms persist or recur repeatedly, and conservative treatments were failed. In addition, eight persons who had lumbar fusion surgery because of lumbar vertebral fracture were also included in the experiment and used as normal controls. Individuals with one of the following circumstances should be excluded: (1) history of osteoarthritis, spondylosis, spondylolisthesis, acute or chronic inflammatory disease, hypertension, or diabetes mellitus; (2) have taken or are currently taking immunosuppressive drugs; and (3) previous surgery for IVD disease.

Patients with LDH can be divided into two groups by using the method described by Cheng et al [33]. In short, patients in whom the annulus fibrosus was intact and the nucleus pulposus was completely sealed by the annulus fibrosus were categorized as non-ruptured group (NR, 13 patients). Patients in whom the annulus fibrosus was ruptured and the nucleus pulposus was not completely sealed by the annulus fibrosus and thus the nucleus pulposus was exposed to circulation were categorized as ruptured group (R, 16 patients). For a diagnosis of rupture, both MRI evidence of rupture and visual observation of rupture during surgery had to be present.

During surgery, after removal of the intervertebral disc, it was immediately washed by phosphate-buffered solution (PBS) for three times to clean the remained blood. Subsequently, the NP was separated from the AF by using a stereotaxic microscope and then the NP was cut into two parts: one was fixed in 10 % neutral formalin and used for morphological observation, and the other was placed in a cryopreservation tube and preserved at −80 °C for reverse transcription polymerase chain reaction (RT-PCR). The characteristics of the enrolled subjects are shown in Table 1.
Table 1

Characteristics of the enrolled subjects

Case no.

Gender

Diagnosis

Age (years)

Level

HE

IHC

RT-PCR

1

F

NC

23

L2

Y

Y

Y

2

M

NC

36

L4

Y

Y

Y

3

M

NC

58

L1

Y

Y

Y

4

M

NC

42

L3

Y

Y

Y

5

F

NC

37

L3

Y

Y

Y

6

M

NC

42

L4

Y

Y

Y

7

M

NC

32

L3

Y

Y

Y

8

M

NC

34

L3

Y

Y

Y

9

F

NR

43

L4/5

Y

Y

Y

10

M

NR

31

L4/5

Y

Y

Y

11

M

NR

39

L5/S1

Y

Y

Y

12

M

NR

42

L4/5

Y

Y

Y

13

F

NR

44

L4/5

Y

Y

N

14

F

NR

48

L4/5

Y

Y

Y

15

M

NR

67

L5/S1

Y

Y

Y

16

M

NR

51

L5/S1

Y

Y

Y

17

F

NR

50

L5/S1

Y

Y

Y

18

M

NR

42

L3/L4

Y

Y

N

19

F

NR

47

L5/S1

Y

Y

Y

20

M

NR

53

L5/S1

Y

Y

Y

21

M

NR

41

L4/5

Y

Y

Y

22

M

R

45

L5/S1

Y

Y

Y

23

F

R

52

L5/S1

Y

Y

Y

24

M

R

43

L4/5

Y

Y

Y

25

F

R

30

L4/5

Y

Y

Y

26

F

R

41

L5/S1

Y

Y

Y

27

M

R

47

L4/5

Y

Y

Y

28

M

R

57

L5/S1

Y

Y

N

29

F

R

41

L5/S1

Y

Y

Y

30

M

R

53

L5/S1

Y

Y

N

31

M

R

52

L5/S1

Y

Y

Y

32

M

R

49

L5/S1

Y

Y

Y

33

F

R

56

L4/5

Y

Y

Y

34

M

R

64

L5/S1

Y

Y

N

35

F

R

39

L4/5

Y

Y

Y

36

M

R

42

L4/5

Y

Y

Y

37

F

R

57

L5/S1

Y

Y

Y

F female, M male, NC normal control group, NR non-ruptured group, R ruptured group, Y yes, N no

HE staining

IVD tissues obtained from the surgery were fixed in 10 % neutral formalin for 24 h. After that, they were dehydrated in alcohol and transparentized in xylene. Then, they were embedded in paraffin wax and cut into 5-μm sections. Subsequently, the sections were dewaxed to water and stained by hematoxylin and eosin (HE) and sealed with neutral gum. The pathological changes of the intervertebral disc were evaluated by using a light microscope (Nikon, Japan).

Immunohistochemical localization of IL-23

IVD specimens obtained from LDH and vertebral fractures were embedded in paraffin, and sections were cut at 4 μm and mounted on slides and dried at 60 °C. Sections were deparaffinized in xylene and rehydrated through graded alcohols to distilled water. Then, the sections were incubated with H2O2 for 10 min to eliminate the activity of endogenous peroxidase, followed by incubation for 2.5 h with human IL-23 immunogen affinity purified polyclonal antibody (Abcam, ab115759) diluted 1:200 in blocking buffer. The sections were washed with PBS and incubated for 30 min with HRP-labeled goat anti-rabbit IgG secondary antibodies (Fitzgerald, 43R-1614, USA) in blocking buffer (1:1000). Color was developed with diaminobenzidine, and the sections were counterstained with hematoxylin for 1 min at room temperature to stain the cell nuclei. Sections were imaged by using a microscope (Nikon, Japan) with ×20 and ×40 objective lenses. Human kidney tissue was used as the positive control.

Semiquantitative grading of IL-23 immunoreactivity in immunostained sections was performed by two graders who evaluated eight separate ×20 magnification fields for each tissue sample. The method was used as previously described by Shamji et al [19]. And this strategy can provide the most complete and comprehensive evaluation of the surgical tissue samples.

Scores were given for degree of cytokine immunoreactivity as follows: 0 = no positive cells and 1 = at least one positively labeled cell.

RT-PCR

As few annulus fibrosus was found in the dissected intervertebral disc tissues in our experiment, and nucleus pulposus was generally believed to play a central role in the pathogenesis of LDH, thus only the nucleus pulposus was prepared for the RNA extraction. Tissue samples were grinded in liquid nitrogen and homogenized in 1 ml TRIzol ®Reagent (Invitrogen, Carlsbad, CA, USA) per 100 mg of tissue. The purity and concentration of the extracted total RNA were evaluated by an ultraviolet spectrophotometer (Thermo Fisher NanoDrop-1000, USA). According to the manufacturer’s protocol, 1 μg of total RNA was used to synthesize cDNA using ReverTra Ace qRCR RT Kit (Toyobo, Osaka, Japan). Real-time PCR amplifications were performed using gene-specific primers in a final concentration about 0.4 μM and SYBR® Green Realtime PCR Master Mix (TOYOBO, OSAKA, JAPAN) according to the manufacturer’s protocol. The primer sequences used this in this experiment are shown in Table 2. The thermal cycling conditions were as follows: an initial denaturation at 95 °C for 1 min, followed by 40 cycles of 10 s of denaturing at 95 °C, 15 s of annealing at 58 °C, and 20 s of extension at 72 °C. The expression levels of the target genes were normalized to that of β-actin in the same cDNA samples.
Table 2

Sequences of primers for the RT-PCR assays

Gene

Sense

Sequence 5′–3′

IL17A

F

CCATAGTGAAGGCAGGAATC

 

R

GAGGTGGATCGGTTGTAGTA

IL23A

F

GACACATGGATCTAAGAGAAGAG

 

R

AACTGACTGTTGTCCCTGAG

IL-1β

F

TGTTGAAAGATGATAAGCCCACTCT

 

R

CAAATCGCTTTTCCATCTTCTTC

IL-6

F

CGGGAACGAAAGAGAAGCTCTA

 

R

GAGCAGCCCCAGGGAGAA

TNF-α

F

CGAGTCTGGGCAGGTCTACTTT

 

R

AAGCTGTAGGCCCCAGTGAGTT

β-actin

F

GCAGAAGGAGATCACTGCCCT

 

R

GCTGATCCACATCTGCTGGAA

Statistical analysis

All tests were performed by using SPSS 19.0. Data were expressed as the mean ± standard deviation (SD). Differences in immunoreactivity score between study groups were determined by using chi-squared test, and differences of cytokines expression levels between study groups were determined by using one-way analysis of variance (ANOVA). Pearson correlation coefficient was used to determine the relationship between IL-23 and IL-17. A two-tailed p < 0.05 was considered statistically significant.

Results

HE staining results

The morphology of the intervertebral disc was observed by using a light microscope (Nikon, Japan). Figure 1a showed the representative results of the three groups. According to the histological performance, we can see that IVD tissues from the ruptured group showed more severely degenerative performance than the other two groups, and there were less degenerative changes in the normal group than the non-ruptured group. To be more specific, in the normal control group, the structures of NP and AF were almost normal, and there were less cracks and small cell clusters in this group; however, in the non-ruptured group, the degenerative changes were more severe, cracks can be seen in this group samples, and there were more small cell clusters in the IVD tissues which is one of the features of degeneration. In the ruptured group, the structures of NP and AF were nearly destroyed, more cracks and fissures can be seen in this group, and it was not rare to see the performances of fibrinoid necrosis, small vessels, and lymphocytes infiltration (Fig. 1b).
Fig. 1

Morphological changes of lumbar intervertebral discs. a H&E staining of intervertebral disc tissues from the three groups. R ruptured group showed the most severe degenerative changes in the NP and AF; there are more degenerative performances in the NR non-ruptured group than the NC normal control group. Magnification: NP nucleus pulpous, in the upper panel, ×100; AF annulus fibrosus, in the lower panel, ×200. b Infiltrated lymphocytes (a) and small vessels (b) can be seen in the IVD tissues from the ruptured group. All magnifications were ×200

Immunohistochemical-staining of IL-23 in IVD tissues

Representative pictures and statistical results of the immunohistological staining of IL-23 in the IVD specimens were shown in Table 3 and Fig. 2a. We can see that there were nearly no positive expressions of IL-23 in the normal control group, and the immunoreactivity of IL-23 in the ruptured group was much higher than that in the non-ruptured group (p < 0.001). Besides, strong positive expressions can be found around the small vessels and the infiltrated inflammatory cells which were shown in Fig. 2b.
Table 3

Immunoreactivity scores of IVD tissues

Cellularity score

Normal control (n = 64)

Non-ruptured group (n = 104)

Ruptured group (n = 128)

0

56

59

32

1

8a

45b

96c

IVD intervertebral disc, 0 no labeled cells, 1 at least one positively labeled cell

a From two patients

b From seven patients

c From 14 patients

Fig. 2

Representative results of IL-23 among different groups. All magnifications ×200. a (a) Human kidney tissues from the positive control. (b) IVD tissues from the normal control group. Nearly no positive cells can be recognized. (c) IVD tissues from the non-ruptured group. Only a few cells showed positive results. (d) IVD tissues from the ruptured group. Much higher positive results can be noted in this group than the other two groups. b In both the ruptured and non-ruptured groups, significant positive results of IL-23 can be found around the small vessels (a) and the infiltrated inflammatory cells (b)

RT-PCR results

In order to investigate the gene expression of IL-23 and other inflammatory cytokines, we performed RT-PCR. The results showed that the mRNA levels of IL-23, IL-17, IL-1β, and TNF-α were significantly higher in the ruptured group when compared to the non-ruptured group, but no expression differences were observed at IL-6 between the two groups, and all above cytokines are least detected in the normal control group (Fig. 3). The association degree of the gene expression between IL-23 and IL-17 was calculated by using Pearson correlation coefficient, and significant positive correlations were observed between them (r = 0.794, p < 0.01).
Fig. 3

Gene expression of several cytokines normalized to β-actin. The results showed that the mRNA levels of IL-23, IL-17, IL-1β, and TNF-α were significantly higher in the ruptured group when compared to the non-ruptured group except IL-6, and all above cytokines are least detected in the normal control group. *p < 0.05

Discussion

IL-23 belongs to the IL12 cytokine family and is composed of the unique IL23p19 subunit and the common IL12p40 subunit which is shared with IL-12. Since Oppmann et al. [37] first reported this new cytokine in the journal of Immunity in 2000, many articles have focused on its biological functions and its potential therapeutic effects in immunorelated diseases. Because of its extensive biological effect in infections, inflammation, autoimmunity, and tumor, IL-23 has caused much attention in many fields in the last few years. In the current study, we found that IL-23 was expressed in IVD tissues by using the method of RT-PCR and immunohistological staining and found that it is much higher in the ruptured group than that in the non-ruptured group.

As macrophages can secrete IL-23 and they are the mainly infiltrated cells in the herniated IVD tissues [19, 38, 39], we may deduce that IL-23 in the IVD tissues is mainly from the secretion of macrophages. As previous studies [19] indicated that more macrophages were infiltrated in the ruptured group than that in the non-ruptured group, this may be one of the reasons why there were more IL-23 expressed in the ruptured group. However, we also noted that some chondrocyte-like cells were also stained positively with IL-23 antibody. This suggests that NP cells may be another source of IL-23. To determine which kind of cells is the primary source, a further study is needed.

When observing the slides, we also found some interesting phenomenon: more degenerative signs, vessels, and infiltrated cells were found in the ruptured group than that in the non-ruptured group. Meanwhile, significant positive results of IL-23 were found around the small blood vessels and in the area with many infiltrated inflammatory cells. So we may speculate that IL-23 may contribute to the deterioration of IVD by facilitating the neovascularization and strengthening the autoimmune reactions. But the specific mechanisms still need to be further studied.

A previous study by Shamji et al. [9] indicated that the dorsal root ganglion (DRG) treated with NP material failed to show an enhancement of IL-23 staining compared with the sham animals, which seems in contrast to the claims that IL-23 may be contributing to pathological changes in lumbar disc herniation. However, in our work, we directly examined the expression of IL-23 in human nucleus pulposus, not using animal tissues or staining on the DRG. The species variation and the auto-antigenic characterization of the nucleus pulposus may explain this point.

IL-17 is a pro-inflammatory cytokine which is initially discovered to be secreted by Th17 cells and has been found to play an important role in many inflammation- and autoimmune-related diseases. It can work alone or synergistically with other pro-inflammatory cytokines, especially IL-1β, IL-6, and TNF-α to increase the production of diverse mediators of inflammation. Recently, studies have indicated that it is also expressed in human IVD tissues and may play a critical role in the pathogenesis of LDH [3336]. Cheng et al. [33] reported that Th17 lymphocytes and IL-17 concentrations are higher in the ruptured than those in the non-ruptured discs and are correlated with pain intensity; this suggests that immune activation is responsible, at least in part, for the pain experienced by patients with LDH.

In the current study, we also found that IL-17 was expressed in IVD tissues and its gene expression was much higher in the ruptured group than that in the non-ruptured group, which is consistent with the former investigations. Besides, we also found that there is a higher expression of IL-1β, IL-6, and TNF-α in IVD tissues from LDH than normal controls, especially in the ruptured group, although there is no difference at IL-6 between the ruptured and non-ruptured groups. We also found that there is a positive correlation between IL-17 and IL-23 gene expression. Since studies have proven that IL-23 is essential for differentiation and maintenance of TH17 cells [40], and IL23/IL-17 axis has been found to be associated with many inflammation related diseases [4144], it can be inferred that this pathway together with other inflammation mediators such as IL-1β, IL-6, and TNF-α may play an important role in the process of LDH.

While the results of this study are encouraging in identifying the expression of IL-23 in IVD tissues, there are some limitations to the report that need to be considered. The included subjects in the study are relatively small, especially in the normal control group. Although infiltrated macrophages seem to be the major source of IL-23, we cannot deny the possibility that it may be secreted by other cells in the disc, so a further study is required to give a definite answer. In addition, we did not study the expression of other cytokines such as IL-22 and MMP-9, which have been reported to be related with IL-23 signaling [45, 46] and may have an important role in the process of LDH.

Conclusions

Our study demonstrated that IL-23 was expressed in IVD tissues, and it was much higher in the ruptured group than that in the non-ruptured group. In light of the previous and current study on IL-17 and IL-23, we may speculate that the canonical inflammatory related signaling IL-23/IL-17 axis may play a critical role in LDH and further study on the specific mechanisms may provide us a new concept in the therapeutic strategies of LDH.

Ethics approval and consent to participate

The study was approved by the institutional ethics review board of Tianjin Hospital, and written informed consent was obtained from each patient.

Abbreviations

HE: 

hematoxylin and eosin

IVDs: 

intervertebral discs

LDH: 

lumbar disc herniation

NP: 

nucleus pulposus

NR group: 

non-ruptured group

R group: 

ruptured group

Declarations

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Orthopaedics, Tianjin Medical University General Hospital
(2)
Tianjin Orthopedics Institute

References

  1. Frymoyer JW, Pope MH, Clements JH, Wilder DG, MacPherson B, Ashikaga T. Risk factors in low-back pain. An epidemiological survey. J Bone Joint Surg Am. 1983;65:213–8.PubMedGoogle Scholar
  2. Kanerva A, Kommonen B, Gronblad M, Tolonen J, Habtemariam A, Virri J, et al. Inflammatory cells in experimental intervertebral disc injury. Spine. 1997;22:2711–5.PubMedView ArticleGoogle Scholar
  3. Olmarker K, Nordborg C, Larsson K, Rydevik B. Ultrastructural changes in spinal nerve roots induced by autologous nucleus pulposus. Spine. 1996;21:411–4.PubMedView ArticleGoogle Scholar
  4. Olmarker K, Iwabuchi M, Larsson K, Rydevik B. Walking analysis of rats subjected to experimental disc herniation. Eur Spine J. 1998;7:394–9.PubMedPubMed CentralView ArticleGoogle Scholar
  5. Otani K, Arai I, Mao GP, Konno S, Olmarker K, Kikuchi S. Nucleus pulposus-induced nerve root injury: relationship between blood flow and motor nerve conduction velocity. Neurosurgery. 1999;45:614–9. discussion 619-620.PubMedView ArticleGoogle Scholar
  6. Olmarker K, Storkson R, Berge OG. Pathogenesis of sciatic pain: a study of spontaneous behavior in rats exposed to experimental disc herniation. Spine. 2002;27:1312–7.PubMedView ArticleGoogle Scholar
  7. Kallakuri S, Takebayashi T, Ozaktay AC, Chen C, Yang S, Wooley PH, et al. The effects of epidural application of allografted nucleus pulposus in rats on cytokine expression, limb withdrawal and nerve root discharge. Eur Spine J. 2005;14:956–64.PubMedView ArticleGoogle Scholar
  8. Murata Y, Nannmark U, Rydevik B, Takahashi K, Olmarker K. Nucleus pulposus-induced apoptosis in dorsal root ganglion following experimental disc herniation in rats. Spine. 2006;31:382–90.PubMedView ArticleGoogle Scholar
  9. Shamji MF, Allen KD, So S, Jing L, Adams Jr SB, Schuh R, et al. Gait abnormalities and inflammatory cytokines in an autologous nucleus pulposus model of radiculopathy. Spine. 2009;34:648–54.PubMedPubMed CentralView ArticleGoogle Scholar
  10. Kang JD, Georgescu HI, McIntyre-Larkin L, Stefanovic-Racic M, Donaldson 3rd WF, Evans CH. Herniated lumbar intervertebral discs spontaneously produce matrix metalloproteinases, nitric oxide, interleukin-6, and prostaglandin E2. Spine. 1996;21:271–7.PubMedView ArticleGoogle Scholar
  11. Kang JD, Stefanovic-Racic M, McIntyre LA, Georgescu HI, Evans CH. Toward a biochemical understanding of human intervertebral disc degeneration and herniation. Contributions of nitric oxide, interleukins, prostaglandin E2, and matrix metalloproteinases. Spine. 1997;22(10):1065–73.PubMedView ArticleGoogle Scholar
  12. O'Donnell JL, O'Donnell AL. Prostaglandin E2 content in herniated lumbar disc disease. Spine. 1996;21:1653–5. discussion 1655-1656.PubMedView ArticleGoogle Scholar
  13. Ozaktay AC, Cavanaugh JM, Asik I, DeLeo JA, Weinstein JN. Dorsal root sensitivity to interleukin-1 beta, interleukin-6 and tumor necrosis factor in rats. Eur Spine J. 2002;11:467–75.PubMedPubMed CentralView ArticleGoogle Scholar
  14. Hoyland JA, Le MC, Freemont AJ. Investigation of the role of IL-1 and TNF in matrix degradation in the intervertebral disc. Rheumatology (Oxford). 2008;47:809–14.View ArticleGoogle Scholar
  15. Olmarker K, Larsson K. Tumor necrosis factor alpha and nucleus-pulposus-induced nerve root injury. Spine. 1998;23:2538–44.PubMedView ArticleGoogle Scholar
  16. Iwabuchi S, Ito M, Chikanishi T, Azuma Y, Haro H. Role of the tumor necrosis factor-alpha, cyclooxygenase-2, prostaglandin E2, and effect of low-intensity pulsed ultrasound in an in vitro herniated disc resorption model. J Orthop Res. 2008;26:1274–8.PubMedView ArticleGoogle Scholar
  17. Le Maitre CL, Hoyland JA, Freemont AJ. Catabolic cytokine expression in degenerate and herniated human intervertebral discs: IL-1beta and TNFalpha expression profile. Arthritis Res Ther. 2007;9(4):R77.PubMedPubMed CentralView ArticleGoogle Scholar
  18. Weiler C, Nerlich AG, Bachmeier BE, Boos N. Expression and distribution of tumor necrosis factor alpha in human lumbar intervertebral discs: a study in surgical specimen and autopsy controls. Spine. 2005;30:44–53. discussion 54.PubMedView ArticleGoogle Scholar
  19. Shamji MF, Setton LA, Jarvis W, So S, Chen J, Jing L, et al. Proinflammatory cytokine expression profile in degenerated and herniated human intervertebral disc tissues. Arthritis Rheum. 2010;62:1974–82.PubMedPubMed CentralGoogle Scholar
  20. Burke JG, Watson RW, McCormack D, Dowling FE, Walsh MG, Fitzpatrick JM. Intervertebral discs which cause low back pain secrete high levels of proinflammatory mediators. J Bone Joint Surg (Br). 2002;84:196–201.View ArticleGoogle Scholar
  21. S. Lee, C.S. Moon, D. Sul, J. Lee, M. Bae, Y. Hong, M. Lee, S. Choi, R. Derby, B.J. Kim, J. Kim, J.S. Yoon, L. Wolfer, J. Kim, J. Wang, S.W. Hwang, S.H. Lee, Comparison of growth factor and cytokine expression in patients with degenerated disc disease and herniated nucleus pulposus, Clin. Biochem. 42(2009)1504–1511.PubMedView ArticleGoogle Scholar
  22. Richardson SM, Doyle P, Minogue BM, Gnanalingham K, Hoyland JA. Increased expression of matrix metalloproteinase-10, nerve growth factor and substance P in the painful degenerate intervertebral disc. Arthritis Res Ther. 2009;11(4):R126.PubMedPubMed CentralView ArticleGoogle Scholar
  23. Haro H, Kato T, Komori H, Osada M, Shinomiya K. Vascular endothelial growth factor (VEGF)-induced angiogenesis in herniated disc resorption. J Orthop Res. 2002;20:409–15.PubMedView ArticleGoogle Scholar
  24. Ohtori S, Inoue G, Koshi T, Ito T, Doya H, Moriya H, et al. Substance P-saporin down-regulates substance P receptor immunoreactive sensory dorsal root ganglion neurons innervating the lumbar intervertebral discs in rats. Spine. 2006;31:2987–91.PubMedView ArticleGoogle Scholar
  25. Stritesky GL, Yeh N, Kaplan MH. IL-23 promotes maintenance but not commitment to the Th17 lineage. J Immunol. 2008;181:5948–55.PubMedPubMed CentralView ArticleGoogle Scholar
  26. Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M, et al. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 2006;441:235–8.PubMedView ArticleGoogle Scholar
  27. Sutton CE, Lalor SJ, Sweeney CM, Brereton CF, Lavelle EC, Mills KH. Interleukin-1 and IL-23 induce innate IL-17 production from gammadelta T cells, amplifying Th17 responses and autoimmunity. Immunity. 2009;31:331–41.PubMedView ArticleGoogle Scholar
  28. Stamp LK, Easson A, Pettersson L, Highton J, Hessian PA. Monocyte derived interleukin (IL)-23 is an important determinant of synovial IL-17A expression in rheumatoid arthritis. J Rheumatol. 2009;36:2403–8.PubMedView ArticleGoogle Scholar
  29. Hollis-Moffatt JE, Merriman ME, Rodger RA, Rowley KA, Chapman PT, Dalbeth N, et al. Evidence for association of an interleukin 23 receptor variant independent of the R381Q variant with rheumatoid arthritis. Ann Rheum Dis. 2009;68:1340–4.PubMedView ArticleGoogle Scholar
  30. Fransen K, van Sommeren S, Westra HJ, Veenstra M, Lamberts LE, Modderman R, et al. Correlation of genetic risk and messenger RNA expression in a Th17/IL23 pathway analysis in inflammatory bowel disease. Inflamm Bowel Dis. 2014;20(5):777–82.PubMedView ArticleGoogle Scholar
  31. Toussirot E. The IL23/Th17 pathway as a therapeutic target in chronic inflammatory diseases. Inflamm Allergy Drug Targets. 2012;11:159–68.PubMedView ArticleGoogle Scholar
  32. Ratsimandresy RA, Duvallet E, Assier E, Semerano L, Delavallee L, Bessis N, et al. Active immunization against IL-23p19 improves experimental arthritis. Vaccine. 2011;29:9329–36.PubMedView ArticleGoogle Scholar
  33. Cheng L, Fan W, Liu B, Wang X, Nie L. Th17 lymphocyte levels are higher in patients with ruptured than non-ruptured lumbar discs, and are correlated with pain intensity. Injury. 2013;44:1805–10.PubMedView ArticleGoogle Scholar
  34. Gruber HE, Hoelscher GL, Ingram JA, Norton HJ, Hanley Jr EN. Increased IL-17 expression in degenerated human discs and increased production in cultured annulus cells exposed to IL-1ss and TNF-alpha. Biotech Histochem. 2013;88:302–10.PubMedView ArticleGoogle Scholar
  35. Gabr MA, Jing L, Helbling AR, Sinclair SM, Allen KD, Shamji MF, et al. Interleukin-17 synergizes with IFNgamma or TNFalpha to promote inflammatory mediator release and intercellular adhesion molecule-1 (ICAM-1) expression in human intervertebral disc cells. J Orthop Res. 2011;29:1–7.PubMedPubMed CentralView ArticleGoogle Scholar
  36. Zhang W, Nie L, Guo YJ, Han LX, Wang X, Zhao H, et al. Th17 cell frequency and IL-17 concentration correlate with pre- and postoperative pain sensation in patients with intervertebral disk degeneration. Orthopedics. 2014;37:e685–691.PubMedView ArticleGoogle Scholar
  37. Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, et al. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity. 2000;13(5):715–25.PubMedView ArticleGoogle Scholar
  38. Rothoerl R, Woertgen C, Holzschuh M, Brehme K, Ruschoff J, Brawanski A. Macrophage tissue infiltration, clinical symptoms, and signs in patients with lumbar disc herniation. A clinicopathological study on 179 patients. Acta Neurochir (Wien). 1998;140:1245–8.View ArticleGoogle Scholar
  39. Kobayashi S, Meir A, Kokubo Y, Uchida K, Takeno K, Miyazaki T, et al. Ultrastructural analysis on lumbar disc herniation using surgical specimens: role of neovascularization and macrophages in hernias. Spine. 2009;34:655–62.PubMedView ArticleGoogle Scholar
  40. Cua DJ, Tato CM. Innate IL-17-producing cells: the sentinels of the immune system. Nat Rev Immunol. 2010;10:479–89.PubMedView ArticleGoogle Scholar
  41. E. Lubberts, The IL-23-IL-17 axis in inflammatory arthritis, Nat Rev Rheumatol. 11(2015)562.Google Scholar
  42. Abbas A, Gregersen I, Holm S, Daissormont I, Bjerkeli V, Krohg-Sorensen K, et al. Interleukin 23 levels are increased in carotid atherosclerosis: possible role for the interleukin 23/interleukin 17 axis. Stroke. 2015;46:793–9.PubMedView ArticleGoogle Scholar
  43. Astry B, Venkatesha SH, Moudgil KD. Involvement of the IL-23/IL-17 axis and the Th17/Treg balance in the pathogenesis and control of autoimmune arthritis. Cytokine. 2015;74(1):54–61.PubMedView ArticleGoogle Scholar
  44. Jia R, Tang M, Qiu L, Sun R, Cheng L, Ma X, et al. Increased interleukin-23/17 axis and C-reactive protein are associated with severity of acute pancreatitis in patients. Pancreas. 2015;44:321–5.PubMedView ArticleGoogle Scholar
  45. Kenna TJ, Brown MA. The role of IL-17-secreting mast cells in inflammatory joint disease. Nat Rev Rheumatol. 2013;9:375–9.PubMedView ArticleGoogle Scholar
  46. Li J, Lau G, Chen L, Yuan YF, Huang J, Luk JM, et al. Interleukin 23 promotes hepatocellular carcinoma metastasis via NF-kappa B induced matrix metalloproteinase 9 expression. PLoS One. 2012;7(9):e46264.PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

© Jiang et al. 2016

Advertisement