Skip to main content

Table 1 Primer sequences for collagen Type I, collagen Type II, aggrecan and GAPDH

From: Self-assembling peptides with hBMP7 biological activity promote the differentiation of ADSCs into nucleus pulposus-like cells

Target gene Forward primer (5′–3′) Reverse primer (3′–5′)
Collagen type I 5′ AAGAAGAAGACATCCCACCAGTC 3′ 3′ ACAACACGCTACTGCACTAGA 5'
Collagen type II 5′ CCCGAACCCACAAACAACA 3′ 3′ CCGAGACGTGACTTACCGA 5'
Aggrecan 5′ CCTACGATGTCTACTGCTATGTGG 3′ 3′ CTTAGAGTATTGCGGTGGGAC 5'
GAPDH 5′ ATGTTTGTGATGGGCGTGAA 3′ 3′TGACGAACCGAGGAGATCGG 5'