Skip to main content

Table 1 Sequences of primers used for quantitative real-time PCR

From: Protective role of the alpha-1-antitrypsin in intervertebral disc degeneration

Gene Forward (5–3′) Reverse (5–3′)
Bax AACTGGGGTCGATTGTG GATCCAAGGCTCTAGGTGGTC
Bcl-2 TTGAGTTCGGTGGGGTCATG GATCCAGGTGTGCAGATGCC
Cleared Caspase-3 TATGGAATTGATGGATAGT CTGAAGAAACTAGTTAGTT
Aggrecan TCCAAACCAACCCGACAAT TCTCATAGCGATCTTTCTTCTGC
COL2A1 ACGCTCAAGTCGCTGAACAA TCAATCCAGTAGTCTCCGCTCT
Collagen II GGGAATGTCCTCTGCGATGAC GAAGGGGATCTCGGGGTTG
MMP-13 CCGAGGAGAAACAATGATCT GCCTGTATCCTCAAAGTGAA
ADAMTS-5 CGACAAGAGTCTGGAGGTGAG CGTGAGCCACAGTGAAAGC
Wnt1 GAATCGCCGCTGGAACTGTC GCGGAGGTGATAGCGAAGATAAACG
β-catenin CAAGTGGGTGGTATAGAGG AGTCCATAGTGAAGGCGAAC
GAPDH TCAAGAAGGTGGTGAAGCAGG TCAAAGGTGGAGGAGTGGGT