Skip to main content

Table 1 Primers for qRT-PCR

From: Expression of miR-195 and its target gene Bcl-2 in human intervertebral disc degeneration and their effects on nucleus pulposus cell apoptosis

Gene Primers (5′-3′)
miR-195 F: CGTAGCAGCACAGAAATATTGGC
  R: CCAGTCTCAGGGTCCGAGGTATTC
U6 F: CTCGCTTCGGCAGCACATATA
  R: ACGCTTCACGAATTTGCGTGTC
TNF-α F: CGAGTCTGGGCAGGTCTACTTT
  R: AAGCTGTAGGCCCCAGTGAGTT
β-actin F: GCAGAAGGAGATCACTGCCCT
  R: GCTGATCCACATCTGCTGGAA