Skip to main content

Table 1 Primer sequences of PCR

From: T-614 attenuates knee osteoarthritis via regulating Wnt/β-catenin signaling pathway

Gene Forward (5′-3′) Reverse (3′-5′)
β-catenin CTTCCAGACACGCCATCATG CACACAGAGTACTTGCGCTC
MMP13 CCTAAGCACCCCAAA ACACC TGGTGATGGCGTAGAACAGT
GSK-3β ATGTATGGTCTGCAGGCTGT GGATGTGCCTTGATTTGGGG
β-actin TCTTCCAGCCTTCCTTCCTG CACACAGAGTACTTGCGCTC
  1. MMP13 matrix metalloproteinase 13, GSK-3β glucogen synthase kinase-3 beta