Skip to main content

Table 2 The information of the primers’ sequencing

From: Bioinformatics analysis and identification of genes and molecular pathways in steroid-induced osteonecrosis of the femoral head

Gene Forward primers Reverse primers
TYROBP TGGTGCTGACAGTGCTCATTGC AGGCGACTCGGTCTCAGTGATAC
MAPK1 ATGGTGTGCTCTGCTTATGATA TCTTTCATTTGCTCGATGGTTG
CXCR1 CTGGGAAATGACACAGCAAAAT GAATCCATAGCAGAACAGCATG
FPR1 CTGTCAGTTATGGGCTTATTGC GCAATAACTCACGGATTCTGAC
FOXO3 AGCCGAGGAAATGTTCGTC CCTTATCCTTGAAGTAGGGCAC
FPR2 AACTTCTCCACTCCTCTGAATG TAATGTGGCCGTGAAAGAAAAG
CXCR2 AAGGTGAATGGCTGGATTTTTG CCCAGATGCTGAGACATATGAA
ACTB TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA