Skip to main content

Table 2 Sequences of primers used

From: Angiotensin II upregulates RANKL/NFATC1 expression in synovial cells from patients with rheumatoid arthritis through the ERK1/2 and JNK pathways

Target genes Primer sequences (5′-3′) GenBank no.
RANKL F: ACTACACCAAGTACCTGCGT NM_003701.4
R: TAGGATCCATCTGCGCTCTG
AT1R F: TCCAAGATGATTGTCCCA NM_032049.3
R: CTATCACCACCAAGCTGT
NFATC1 F: GCATCACAGGGAAGACCGTGTC NM_001278675.2
R: GAAGTTCAATGTCGGAGTTTCTGAG
GAPDH F: AACGGGAAGCTTGTCATC NM_001357943.2
R: ACTCCACGACGTACTCAG