Skip to main content

Table 1 RT-qPCR primers

From: MiR-140-3p inhibits the cell viability and promotes apoptosis of synovial fibroblasts in rheumatoid arthritis through targeting sirtuin 3

Target gene Forward primers, 5′-3′ Reverse primers, 5′-3′
miR-140-3p TGTGTCCTGCCAGTGGTTTT GTCCGTGGTTCTACCCTGTG
SRIT3 ACCCAGTGGCATTCCAGAC GGCTTGGGGTTGTGAAAGAAG
Ki67 ACGCCTGGTTACTATCAAAAGG CAGACCCATTTACTTGTGTTGGA
Bcl-2 GGTGGGGTCATGTGTGTGG CGGTTCAGGTACTCAGTCATCC
Bax CCCGAGAGGTCTTTTTCCGAG CCAGCCCATGATGGTTCTGAT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG