Skip to main content

Table 2 Primers used in qRT-PCR

From: The protective effects of PI3K/Akt pathway on human nucleus pulposus mesenchymal stem cells against hypoxia and nutrition deficiency

GenesSense primerAntisense primer
Oct4GTGAGAGGCAACCTGGAGAAGAACCACACTCGGACCACAT
jaggedCGAGGACTATGAGGGCAAGACTTCAGGTGTGTCGTTGGAA
Notch1GCCAGAGTGGACAGGTCAGTACACACACGCAGTTGTAGCC
NanogAGGCAAACAACCCACTTCTGTCTGCTGGAGGCTGAGGTAT
Collagen ICCTGGAAAGAATGGAGATGATGATCCAAACCACTGAAACCTCTG
Collagen IIGGTAAGTGGGGCAAGACTGTTATGTTGTTTCTGGGTTCAGGTTT
AggrecanGTCAGATACCCCATCCACACTCCATAAAAGACCTCACCCTCCAT
PI3KACCAGCACTGCCTCCTAAACTCTTCATCATCTTCCACCAGTG
AktACTCTTTCCAGACCCACGACCCAAAGAAGCGATGCTGCATG