Skip to main content

Table 1 The sequences of primers in the qRT-PCR assay

From: Nerve growth factor-chondroitin sulfate/hydroxyapatite-coating composite implant induces early osseointegration and nerve regeneration of peri-implant tissues in Beagle dogs

ID Sequence (5′-3′)
GAPDH Forward: AAGGTCGGAGTCAACGGATTT
GAPDH Reverse: GGCATCAGCAGAAGGAGCAG
TrkA Forward: CTCTACCGCAAGTTCACCACG
TrkA Reverse: TGATGCACTCAATCGCCTCG
p75 Forward: CAACCTCATCCCTGTCTACTGCT
p75 Reverse: GGCTCCTTGCTTGTTCTGCTT
OCN Forward: GTGCTGAATCCCGCAAAGG
OCN Reverse: CATACTTCCCTCTTGGGCTCC
Runx-2 Forward: GACCAGCAGCACTCCATATCTCT
Runx-2 Reverse: CTTCCATCAGCGTCAACACCA
Nestin Forward: CTTGCTGTTGGCACCCTTCC
Nestin Reverse: CCAGGACACTCACGCACGAA
NF Forward: AAGAAGCCAAACCCAAAGAGAAG
NF Reverse: GGGTCTTCTCCTCCTTGACATCTT
Tubulin β-4 Forward: TTCATCGGCAACAGCACAGC
Tubulin β-4 Reverse: GGTACTCAGACACCAGGTCATTCA