Skip to main content

Table 1 Human primers used for the quantitative PCR evaluation

From: Direct comparison of 3D and 2D cultivation reveals higher osteogenic capacity of elderly osteoblasts in 3D

Gene Forward primer 5ʼ ➔ 3ʼ Reverse primer 5ʼ ➔ 3ʼ Accession number
OC CCAGCGGTGCAGAGTCCAGC GACACCCTAGACCGGGCCGT NM-199173.3
OP CTCCATTGACTCGAACGACTC CGTCTGTAGCATCAGGGTACTG NM-000582
ALP CTGGGCTCCAGGGATAAAGC TCAGTGTCTCTTGCGCTTGG NM-000478.4
OPG CCGGAAACAGTGAATCAACTC AGGTTAGCATGTCCAATGTG NM-002546.3
COL1 AGCGGACGCTAACCCCCTCC CAGACGGGACAGCACTCGCC NM-000088.3
β-Tub GAGGGCGAGGACGAGGCTTA TCTAACAGAGGCAAAACTGAGCACC NM-001069.2
  1. OC osteocalcin, OP osteopontin, ALP alkaline phosphatase, OPG osteoprotegerin, Col1 collagen type 1α1, β-Tub β-tubulin