Skip to main content

Table 5 List of primers used for qRT-PCR validation

From: Investigating the molecular control of deer antler extract on articular cartilage

Gene Primer Sequence
Hapln1 Forward primer GACAGCTACACTCCGGATCA
  Reverse primer AGCCAAATGCTGTAGGGTCT
Col9a1 Forward primer CCAGCACATCAAGCAGGTTT
  Reverse primer CCTCCCAGGAAGACCAGAAG
Scrg1 Forward primer CCTTGTCATCCTCGGGCTAA
  Reverse primer AACAGGAGAGGCGACTTGAA
Comp Forward primer CAGCTCAAGGCTGTCAAGTC
  Reverse primer CTTCCAGCCCACATTTCGAG
Cnmd Forward primer TTACCACCAGCAGGAAGGAG
  Reverse primer TGAGCGACACCCTTGGTAAT
Ca2 Forward primer TCCTTGCTCCCTTCTTCCTG
  Reverse primer CAGGTCACACATTCCAGCAG
Col1a1 Forward primer ACCTCAGGGTATTGCTGGAC
  Reverse primer GACCAGGGAAGCCTCTTTCT
S100a4 Forward primer GCTGCATTCCAGAAGCTGAT
  Reverse primer CATCATGGCAATGCAGGACA
Fabp4 Forward primer ATGTGCAGAAGTGGGATGGA
  Reverse primer GTCACGCCTTTCATGACACA
Col4a1 Forward primer CCTCCAGGAACGACTACTCC
  Reverse primer GCACACCTGCTAATGAAGGG
Creb3l1 Forward primer CAGCTGCAGAAACTCCAGAC
  Reverse primer CCAGAACAAAGCACAAGGCT
Ccl9 Forward primer TCGTACATGCGACAGAGACA
  Reverse primer TGGACCCGTGAGGTATAGGA