Skip to main content

Table 1 Primer’s sequences of the targeted genes used for real-time PCR

From: Osmolarity influences chondrocyte repair after injury in human articular cartilage

Target gene Orientation Primer sequence (5′-3′)
β-actin Forward CACCATTGGCAATGAGCGGTTC
Reverse AGGTCTTTG CGGATGTCCACGT
HIF-1α Forward TATGAGCCAGAAGAACTTTTAGGC
Reverse CACCTCTTTTGGCAAGCATCCTG
Collagen II Forward CCTGGCAAAGATGGTGAGACAG
Reverse CCTGGTTTTCCACCTTCACCTG