Skip to main content

Table 1 Primer sets used for Real-Time PCR analysis

From: Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs

Gene Orientation Primer Sequence Amplicon Size Melt Temp
GAPDH FOR GTGACTTCAACAGTGACACC 152 84.7
  RC CCTTGGAGGCCATGTAGACC   
Aggrecan FOR ATCGAAGGGGACTTCCGCTG 106 84.5
  RC ATCACCACACAGTCCTCTCCG   
COL 2 FOR GGCCTGTCTGCTTCTTGTAA 197 83.3
  RC ATCAGGTCAGGTCAGCCATT   
COL 1 FOR TGCACGAGTCACACTGGAGC 124 85.5
  RC ATGCCGAATTCCTGGTCTGG   
TIMP 1 FOR GCAGAAGTCAACCAGACCGA 311 86.2
  RC GCAAGTATCCGCAGACGCTC   
TIMP 2 FOR AACGGCAAGATGCACATCAC 142 85.5
  RC ATATAGCACGGGATCATGGG   
INOS FOR GCTATGCTGGCTACCAGATG 139 88.3
  RC ATCAGCCTGCAGCACCAGAG   
COX-2 FOR ACACTCTACCACTGGCATCC 196 83.5
  RC GCTACTTGTTGTACTGCAGC   
MMP-1 FOR CCTAGAACCGTGAAGAGCAT 150 80
  RC CAGGAAAGTCAGCTGCTATC   
MMP 3 FOR ATGGCATCCAGTCCCTGTAT 161 86.5
  RC AAAGAACAGGAACTCTCCCC   
MMP 13 FOR TCTGGTCTTCTGGCTCATGC 141 82.7
  RC GGTCAAGACCTAAGGAGTGG   
ADAMTS4 FOR CATCACTGAGTTCCTGGACA 106 84.5
  RC CGATCAGCGTCATAGTCCTT   
ADAMTS5 FOR TGACTTCTTGCATGGCATGG 120 81.5
  RC CTGGCATGGCTGGTGACTGA   
  1. Canine primer sets used for real-time PCR analysis. The annealing temperature used for all analysis was 57°C. The melt temperature for the amplicon was obtained from the Rotorgene software and is indicative of a specific PCR reaction.