Skip to main content

Table 2 Primer sequences used for qPCR

From: A gene expression profile for the lower osteogenic potent of bone-derived MSCs from osteoporosis with T2DM and the potential mechanism

Genes Forward (5′–3′) Reverse (5′–3′)
RUNX2 TGGTTACTGTCATGGCGGGTA TCTCAGATCGTTGAACCTTGCTA
COL1A1 GAGGGCCAAGACGAAGACATC CAGATCACGTCATCGCACAAC
OPN CTCCATTGACTCGAACGACTC CAGGTCTGCGAAACTTCTTAGAT
SPI1 GTGCCCTATGACACGGATCTA AGTCCCAGTAATGGTCGCTAT
RBAK AAGCTATGCTAGGACAAAACCTG GCTTCTCCCCTATGTAAGCTCTC
PLEK AAGAAGGGGAGCGTGTTCAAT TCAGCGGGATCATTCCTTTGG
DLX3 TACCCTGCCCGAGTCTTCTG TGGTGGTAGGTGTAGGGGTTC
FERD3L GCTGGACTTCGTCGCAGAC GCCTAATAGGGAGACACCTCTTC
FOXQ1 CACGCAGCAAGCCATATACG CGTTGAGCGAAAGGTTGTGG
BARX1 TTCCACGCCGGACAGAATAGA AGTAAGCTGCTCGCTCGTTG
PITX1 GTTCAGCGGCCTAGTGCAG CGGGCTCATGGAGTTGAAGAA
GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG