Skip to main content

Table 1 Information on primer sequences

From: Long noncoding RNA PVT1 promotes chondrocyte extracellular matrix degradation by acting as a sponge for miR-140 in IL-1β-stimulated chondrocytes

Gene Sequences (5′–3′)
PVT1 Forward primer: CTGAAGGTTCCTAAGCCTCTAAG
Reverse primer: AGTGGTTTTTCCATTATTGGTATT
miR-140 Forward primer: CCCCCAGTGGTTTTACCCTA
Reverse primer: GTGCGTGTCGTGGAGTCG
ADAMTS-5 Forward primer: GATGGCACTGAATGTAG
Reverse primer: ACTCCGCACTTGTC
MMP-13 Forward primer: ATGCATCCAGGGGTCCTGGC
Reverse primer: TGCTGCATTCTCCTTCAGGA
U6 Forward primer: GCTTCGGCAGCACATATACTAAAAT
Reverse primer: CGCTTCACGAATTTGCGTGTCAT
GAPDH Forward primer: CCCATCACCATCTTCCAGGAG
Reverse primer: CTTCTCCATGGTGGTGAAGACG
  1. PVT1 plasmacytoma variant translocation 1, miR-140 microRNA-140, ADAMTS-5 ADAM metallopeptidase with thrombospondin type 1 motif-5, MMP-13 matrix metalloproteinase-13, GAPDH glyceraldehyde-3-phosphate dehydrogenase