Skip to main content

Table 1 Primer sequences for RT‐qPCR

From: Discoidin domain receptor 2 activation of p38 mitogen-activated protein kinase as an important pathway for osteonectin-regulating osteoblast mineralization

Target gene Primer sequence (5′–3′)
Mouse COL1 a1 F: GACGCCATCAAGGTCTACTG
R: ACGGGAATCCATCGGTCA
Mouse COL1 a2 F: GGAGGGAACGGTCCACGAT
R: GAGTCCGCGTATCCACAA
Mouse DDR2 F: CTCCCAGAATTTGCTCCAG
R: GCCACATCTTTTCCTGAGA
Mouse P38 F: GGATATTTGGTCCGTGGGCT
R: CCGTCAGACGCATTATCTGC
Mouse OPN F: CCAGCCAAGGACCAACTACA
R: AGTGTTTGCTGTAATGCGCC
Mouse BSP F: AGAAAGAGCAGCACGGTTGA
R: AATCCTGACCCTCGTAGCCT
Mouse OCN F: ATTGTGACGAGCTAGCGGAC
R: TCGAGTCCTGGAGAGTAGCC
Mouse GAPDH F: CCTGCACCACCAACTGCTTA
R: CATCACGCCACAGCTTTCCA
  1. COL1 Collagen 1; DDR2 Disc protein domain receptor 2; P38 P38 mitogen‐activated protein kinase; BSP bone sialoprotein; OCN osteocalcin; F forward; R reverse; RT‐qPCR reverse transcription-quantitative polymerase chain reaction