Skip to main content

Table 1 Sequences of the primers used in this study

From: Increasing transforming growth factor-beta concentrations with age decrease apelin in the rat rotator cuff

Primer Sequence (5′-3′) Product size (bp)
Tgfb-F GACCGCAACAACGCAATCTA 110
Tgfb-R GACAGCAATGGGGGTTCTGG
Apelin-F CTTGACTGCCGTGTGTGGA 72
Apelin-R CGCATGTTGCCTTCTTCTAGC
Tnmd-F AACAAATCGTAGCACGGGAG 102
Tnmd-R AGTCGGCTAACAGATGCCAG
Col1a1-F GTCCCTAATGGTGAGACGTGG 122
Col1a1-R CGTTTTTGGGGGTTGGGACA
Col3a1-F ACACCTGCTCCTGTCATTCC 99
Col3a1-R AAGACCAGGGTCGCCATTTC
Gapdh-F TGCCACTCAGAAGACTGTGG 129
Gapdh-R TTCAGCTCTGGGATGACCTT