Skip to main content

Table 1 The sequences of all primers used in qRT-PCR

From: MiR-330-5p inhibits intervertebral disk degeneration via targeting CILP

Gene name Primer sequence (5′-3′)
CILP Forward: GCAAAAGCATCCTGAAGATCAC
Reverse: GGAGTCTCTGCCCTCACAAAC
ACAN Forward: ACCAGACTGTCAGATACCCC
Reverse: CATAAAAGACCTCACCCTCC
COL1A1 Forward: TGACCTCAAGATGTGCCACT
Reverse: ACCAGACATGCCTCTTGTCC3
COL2A1 Forward: ATTGCCTATCTGGACGAAGC
Reverse: GCAGTGTACGTGAACCTGCT
MMP-3 Forward: GCATTGGCTGAGTGAAAGAGAC
Reverse: ATGATGAACGATGGACAGATGA
MMP-9 Forward: GGGACGCAGACATCGTCATC
Reverse: GGGACCACAACTCGTCATCG
miR-330-5p Forward: TCTCTGGGCCTGTGTCTTAG
Reverse: CAGTGCGTGTCGTGGAGT
β-actin Forward: GTGGGGCGCCCCAGGCACCA
Reverse: CTTCCTTAATGTCACGCACGATTTC
U6 Forward: GTGCTCGCTTCGGCAGCACATATAC
Reverse: AAAAATATGGAACGCTTCACGAATTTG