Skip to main content

Table 2 The oligo sequences for transfection in this study

From: Circ-AFF2/miR-650/CNP axis promotes proliferation, inflammatory response, migration, and invasion of rheumatoid arthritis synovial fibroblasts

Name Sequence (5′-3′)
si-circ-AFF2 ACCUUUGUUUGUUUCACUUGU
si-NC UGGAAAGAAACAUUCACUUGU
miR-3612 mimic AGGAGGCAUCUUGAGAAAUGGA
miR-650 mimic AGGAGGCAGCGCUCUCAGGAC
miR-NC CGAUCGCAUCAGCAUCGAUUGC
anti-miR-650 GUCCUGAGAGCGCUGCCUCCU
anti-NC CAGUACUUUUGUGUAGUACAA
\