Skip to main content

Table 1 The primer sequences for qRT-PCR in this study

From: Circ-AFF2/miR-650/CNP axis promotes proliferation, inflammatory response, migration, and invasion of rheumatoid arthritis synovial fibroblasts

Name Sequence (5′-3′)
Forward Reverse
miR-3612 GCCGAGAGGAGGCATCTTGAG AGTGCAGGGTCCGAGGTATT
miR-650 GCCGAGAGGAGGCAGCGCTC AGTGCAGGGTCCGAGGTATT
U6 CAGGTCTCGGGAGAGAGATCG TGTCGTCTTGGAGATCGGGAG
circ-AFF2 TCTTGGATGGAAAACCCAGT AGTTTCCAAGCGTGTTCTGG
CNP GGAAAGCGCACGCTTAGGAG GGCAGGAATGTGTGGCTTTT
ANKRD52 TGGCGAGACCGGAATCCT CCTTTTTCCAGGAGGGGTGG
AXL CACGCGTAAACAACACGCA GTTATGGGCTTCGCAGGAGA
HNRNPUL1 CTGCTTTCTGGAGCCGAAGA GGGTGCTCCTTGCTTCATCT
APBB2 CTCCTTTGTTTGCAGGGATTTTGC TGGCATTCTTCCGTTCAGCC
RAC1 TGATGCAGGCCATCAAGTGT AGAACACATCTGTTTGCGGA
CTSB ATCATGTGGGTGAGCCAGTG TGGGGCAGCGAGAAGTTAAG
PLEC TCATCCAGGCCTACGAGGAG CCAGCAGGGAGATGAGGTTG
CD274 TTGCTGAACGCCCCATACAA CCCCGATGAACCCCTAAACC
GAPDH TTCTTTTGCGTCGCCAGGTG GGAGGGAGAGAACAGTGAGC
\