Skip to main content

Table 1 Sequence of primers used in ARMS

From: Genetic markers of osteoarthritis: early diagnosis in susceptible Pakistani population

SNPs Primer Sequence
TGF β1-29C/T (rs1800470) T allele 5′AGGCGTCAGCACCAGTAG3′
C allele 5′ACCACACCAGCCCTGTTC3′
Reverse (common primer) 5′TAGCAGCAGCAGCAGCA3′
Internal control (reverse) 5′GCATCTTGCTCTGTGCAGAT3′
Internal control (forward) 5′TGCCAAGTGGAGCACCCAA3′
IL-6-174G/C (rs1800796) T Allele 5′GGATTATGAAGAAGGTAATACTA3′
C Allele 5′CACGAAATTTGAGGATGG3′
Reverse (common primer) 5′ACAACAGCCCCTCACAGG3′
Internal control (reverse) 5′CAACTTCATCCACGTTCACC3′
Internal control (forward) 5′ACACAACTGTGTTCACTAGC3′
CALM1-16C/T (rs12885713) T allele 5′GCACCATATATATATCGCGAGGT3′
C allele 5′GCACCATATATATATCGCGAGC3′
Reverse (common primer) 5′ACTCCCGACCTACCATGGT3′
Internal control (reverse) 5′GCATCTTGCTCTGTGCAGAT3′
Internal control (forward) 5′TGCCAAGTGGAGCACCCAA3′