Skip to main content

Table 1 Primer sequence list

From: Lysosomal autophagy promotes recovery in rats with acute knee injury through TFEB mediation

Primer namePrimer sequencePrimer size (bp)
GAPDH-FCCTGGAGAAACCTGCCAAGTA201
GAPDH-RTCATACCAGGAAATGAGCTTGAC 
NITF-FACTGTTCTGGGGGTTTGCG200
NITF-RCTGGGTTTTGATGGAATAGGAG 
Bcl2-FATTATAGAGCGATACAAGGGGG202
Bcl2-RTCTCGTACACTTCGGAGATGG 
TYR-FTGCGGCAGGCTCTATCCAGAGG201
TYR-RCCACTGCCACCGACAGCGTC