Skip to main content

Table 1 Primer sequences for qRT-PCR

From: miR-1249-5p regulates the osteogenic differentiation of ADSCs by targeting PDX1

Gene Forward primer 5′-3′ Reverse primer 5′-3′
GAPDH GACAGTCAGCCGCATCTTCT GCGCCCAATACGACCAAATC
U6 GGCTTTTTGCGGTCTGG GCTTCGGCAGCACATATACTAAAAT
miR-1249-5p ACACTCCAGCTGGGTTCACAGTGGCTAAG AGGGCTTAGCTGCTTGTGAGCA
OSX AGACCTCCAGAGAGGAGAGAC GGGGACTGGAGCCATAGTGA
ALP AATAGCCCTGGCAGATTCCC CTCTCATGGTGTCTCGGTGG
PDX1 TGCCACTGTTGAGTGCAAGTC ACCTGGAGAAGCCGAAGGTAA