Skip to main content

Table 1 Primers used in this study*

From: Optimization of tenocyte lineage-related factors from tonsil-derived mesenchymal stem cells using response surface methodology

 GeneForward Primer (5'->3')Reverse Primer (5'->3')
AdipogenicPPARγGAGGCAGCAGAGGTTAACAGACACCGAGGCGTAAAGTACCA
LPLCCGCCGACCAAAGAAGAGATTAGCCACGGACTCTGCTACT
FABP4TGGGCCAGGAATTTGACGAACACATGTACCAGGACACCCC
OsteogenicRUNX2CCTACCTGAGCCAGATGACGATGCTGGGTGGCCTGAAAT
ALPGAATCTTCCCCAAGGGCCAACAGAATGTTCCACGGAGGCT
BGLAPTCCTTTGGGGTTTGGCCTACCCAGCCTCCAGCACTGTTTA
ChondrogenicSOX9AGGAAGTCGGTGAAGAACGGAAGTCGATAGGGGGCTGTCT
COL2GCTCCTGCCGTTTCGCTGATTATACCTCTGCCCATCCTGC
ACANCTTCCGCTGGTCAGATGGACCGTTTGTAGGTGGTGGCTGT
TenogenicSCXACAGATCTGCACCTTCTGCCGCCACCTCCTAACTGCGAAT
TNMDTCCCTCAGGCTCTGGTATGAAGGACTGAGAGACCACTGCT
DCNTGCCAAAGGATCTTCCCCCTAGGTGTAAATGCTCCAGGACT
COL1A1AGTGGTTTGGATGGTGCCAAGCACCATCATTTCCACGAGC
COL3A1TGGAGGATGGTTGCACGAAAACAGCCTTGCGTGTTCGATA
TNCATGGGCAGACGCACCATTAGTGTGCATCGACCTTCACAAGA
Internal control18S rRNAGTAACCCGTTGAACCCCATTCCATCCAATCGGTAGTAGCG
  1. *NCBI/ Primer-BLAST: Finding primers specific to your PCR template (using Primer3 and BLAST). Available from: https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (Assessed on 15 December 2017)