Skip to main content

Table 1 Primer sequences used in real-time quantitative PCR

From: Effects of cell phenotype and seeding density on the chondrogenic capacity of human osteoarthritic chondrocytes in type I collagen scaffolds

GenePrimer sequencesLength(bp)
COL2-a1F:5′GGACTTTTCTCCCCTCTCT104
 R:5′GACCCGAAGGTCTTACAGGA 
COL1-a1F:5′AGAGGAAGGAAAGCGAGGAG120
 R:5′GGACCAGCAACACCATCTG 
ACANF:5′AGAATCAAGTGGAGCCGTGT116
 R:5′GGGTAGTTGGGCAGTGAGAC 
VCANF:5′TGTTCCTCCCACTACCCTTG122
 R:5′CTTCCACAGTGGGTGGTCTT 
COMPF:5′TCAGGACTCTCGGGACAACT117
 R:5′CTGTCAGGGACTCCGTCATT 
BMP-2F:5′GTCCTGAGCGAGTTCGAGTT115
 R:5′AGTGCCTGCGATACAGGTCT 
SOX-9F:5′GGAATGTTTCAGCAGCCAAT115
 R:5′TGGTGTTCTGAGAGGCACAG 
MMP-13F:5′GCAGTCTTTCTTCGGCTTAGAG100
 R:5′GTATTCACCCACATCAGGAACC 
ADAMTS-5F:5′TGTGAAGAGACCTTTGGTTCC111
 R:5′TTCTGTGATGGTGGCTGAAG 
GAPDHF:5′GTCTCCTCTGACTTCAACAGCG131
 R:5′ACCACCCTGTTGCTGTAGCCAA