Skip to main content

Table 1 Sequences of primers used for qRT-PCR

From: Downregulation of type I collagen expression in the Achilles tendon by dexamethasone: a controlled laboratory study

GeneSpeciesForward primer (5′→3′)Reverse primer (3′→5′)
Col IHumanTGGTGAGACGTGGAAACCTGCTTGGGTCCCTCGACTCCTA
Col IRatsTGGCAAAGAAGGCGGCAAAGGAGGAGCACCAGCAGGACCATC
GAPDH TGACTTCAACAGCAACTCTGTAGCCATATTCATTGTCA