Skip to main content

Table 2 Primer information of miRNA for quantitative reverse transcription

From: Knockdown of miR-660 protects nucleus pulposus cells from TNF-a-induced apoptosis by targeting serum amyloid A1

NamePrimer namePrimer sequence (5′ to 3′)
miR-660miR-660-FTACCCATTGCATATCGG
miR-660-RGTGCAGGGTCCGAGGT
sU6-FTGTGTCCGTCGTGGATCTGA
U6-RCCTGCTTCACCACCTTCTTGA