Skip to main content

Table 1 Primer sequences

From: The BMP signaling pathway enhances the osteoblastic differentiation of bone marrow mesenchymal stem cells in rats with osteoporosis

GeneSequence
BMP-2F: 5′-AACGAGAAAAGCGTCAAGCCFF -3′
R: 5′- CCAGTCATTCCACCCCACAFF -3′
Smad1F: 5′- CAGCAGAGGAGATGTTCAGGCA -3′
R: 5′- TGCACGAAGATGCTGCTGTCAC -3′
Runx2F: 5′- TGAGCGACGTGAGCCCGGTA -3′
R: 5′- CGTGTGGAAGACAGCGGCGT -3′
OCF: 5′- CCTGGCAGGTGCAAAGCCCA -3′
R: 5′- TGCGCTTGTAGGCGTCCTGG-3′
OPNF: 5′- TGCCTGTTCGGCCTTGCCTC -3′
R: 5′- TCCAGGCTGGCTTTGGAACTCG-3′
GAPDHF: 5′- CAAGTTCAACGGCACAGTCA -3′
R: 5′- CCCCATTTGATGTTAGCGGG-3′