Skip to main content

Table 3 Primers for real-time polymerase chain reaction

From: Surface mineralized biphasic calcium phosphate ceramics loaded with urine-derived stem cells are effective in bone regeneration

Target geneForward primer sequence (5-3)Reverse primer sequence (5-3)
RUNX2CCAACCCACGAATGCACTATCTAGTGAGTGGTGGCGGACATAC
BMP2ACCCGCTGTCTTCTAGCGTTTTCAGGCCGAACATGCTGAG
ALPACCACCACGAGAGTGAACCACGTTGTCTGAGTACCAGTCCC
OCNCCCCCTCTAGCCTAGGACCACCAGGTAATGCCAGTTTGC
GAPDHACAACTTTGGTATCGTGGAAGGGCCATCACGCCACAGTTTC