Skip to main content

Table 1 The gene primer used in this study

From: The mechanism of miR-889 regulates osteogenesis in human bone marrow mesenchymal stem cells

Gene namesSequence
WNT7AForward 5′-TGG ATG CCC GGG AGA TC-3′
Reverse 5′-CCG ACC CGC CTC GTT ATT-3′
miR-889Forward 5′ACACTCCAGCTGGGAATGGCTGTCCGTAGT 3′
Reverse 5′TGGTGTCGTGGAGTCG 3′
U6Forward 5′CTCGCTTCGGCAGCACATATACT3′
Reverse 5′ACGCTTCACGAATTTGCGTGTC3′
GADPHForward 5′AAGGTGAAGGTCGGAGTCA3′
Reverse 5′GGAAGATGGTGATGGGATTT3′