Skip to main content

Table 1 The sequences of primers

From: High-fat and high-glucose microenvironment decreases Runx2 and TAZ expression and inhibits bone regeneration in the mouse

Genes Primers Primers sequence (5′-3′)
GAPDH Forward GTGGTAGGCAGTCCCACTTT
Reverse GAGCACTCACTGACTCGGTT
Runx2 Forward CTAGCCAGCAGCGTCGTCATG
Reverse GCAAGACTGGTGGTTGGAGACG
TAZ Forward TGCACCACCAACTGCTTAG
Reverse GGATGCAGGGATGATGTTC