Skip to main content

Table 1 The list of primers used in this study

From: Bi-directional regulation of cartilage metabolism by inhibiting BET proteins—analysis of the effect of I-BET151 on human chondrocytes and murine joints

Gene Strand Primer sequences (5′ to 3′) Detection
MMP1 Forward CTCTGGAGTAATGTCACACCTCT RT-PCR
Reverse TGTTGGTCCACCTTTCATCTTC
MMP3 Forward AGTCTTCCAATCCTACTGTTGCT RT-PCR
Reverse TCCCCGTCACCTCCAATCC
MMP13 Forward ACTGAGAGGCTCCGAGAAATG RT-PCR
Reverse GAACCCCGCATCTTGGCTT
ADAMTS4 Forward GAGGAGGAGATCGTGTTTCCA RT-PCR
Reverse CCAGCTCTAGTAGCAGCGTC
MMP2 Forward TACAGGATCATTGGCTACACACC RT-PCR
Reverse GGTCACATCGCTCCAGACT
MMP9 Forward TGTACCGCTATGGTTACACTCG RT-PCR
Reverse GGCAGGGACAGTTGCTTCT
ADAMTS5 Forward GAACATCGACCAACTCTACTCCG RT-PCR
Reverse CAATGCCCACCGAACCATCT
COL2A1 Forward TGGACGATCAGGCGAAACC RT-PCR
Reverse GCTGCGGATGCTCTCAATCT
ACAN Forward CCCCTGCTATTTCATCGACCC RT-PCR
Reverse GACACACGGCTCCACTTGAT
SOX9 Forward AGCGAACGCACATCAAGAC RT-PCR
Reverse CTGTAGGCGATCTGTTGGGG