Skip to main content

Table 1 Sequences of the primers used in this study

From: Activation of calcitonin gene-related peptide signaling through the prostaglandin E2-EP1/EP2/EP4 receptor pathway in synovium of knee osteoarthritis patients

Primer Sequence (5′–3′) Product size (bp)
CGRP-F TTGCCCAGAAGAGAGCCTGTG 91
CGRP-R TTGTTCTTCACCACACCCCCTG
Cox-2-F TGGCTGAGGGAACACAACAG 74
Cox-2-R AACAACTGCTCATCACCCCA
IL-6-F GAGGAGACTTGCCTGGTGAAA 199
IL-6-R TGGCATTTGTGGTTGGGTCA
IL-1β-F GTACCTGTCCTGCGTGTTGA 153
IL-1β-R GGGAACTGGGCAGACTCAAA
TNF-α-F CTTCTGCCTGCTGCACTTTG 118
TNF-α-R GTCACTCGGGGTTCGAGAAG
RAMP1-F GGCCTCTGGCTGCTCCTG 172
RAMP1-R GCTCCCTGTAGCTCCTGATG
CLR-F TGCAAGACCCCATTCAACAAG 70
CLR-R TTCCAGCAGAGCCATCCATC
GAPDH-F TGTTGCCATCAATGACCCCTT 202
GAPDH-R CTCCACGACGTACTCAGCG