Skip to main content

Table 1 Primers used for real-time RT-PCR

From: Effect of parathyroid hormone on early chondrogenic differentiation from mesenchymal stem cells

Gene Direction Sequences (5′–3′)
Sox9 Forward TACGACTGGACGCTGGTGCC
Sox9 Reverse CCGTTCTTCACCGACTTCCTCC
Col2a1 Forward CTGACCTGACCTGATGATACC
Col2a1 Reverse CACCAGATAGTTCCTGTCTCC
Col10a1 Forward CGAGGTATGCTTGATCTG
Col10a1 Reverse GACAGTCCAGTTCTTCAT
Col1a1 Forward TGACTGGAAGAGCGGAGAGT
Col1a1 Reverse TCTCTCCAAACCAGACGTGC
PTH1R Forward CTCCTTCTCTGCTGCCCAGT
PTH1R Reverse TGCTGTGTGCAGAACTTCCT
GAPDH Forward TGAAGCAGGCATCTGAGGG
GAPDH Reverse CGAAGGTGGAAGAGTGGGAG