Skip to main content

Table 1 Primers of collagen-1 , integrin-β1 , FAK , and β-actin

From: Rabbiteye blueberry prevents osteoporosis in ovariectomized rats

Gene name Forward primer Reverse primer
Collagen-1 ATCAAGGTCACTGCAACAT CAGGATCAAACCTTCGCTT
Integrin-β1 CCCTTTCCTCAGAAGTCATTTTG TTCGCTTTGGCATTCACATTCAC
FAK CGGGATCCGCATCAGCATA CCCAAGCTTTTAGTGCCTG
β-actin TCT TCC AGC CTT CCT TCC TG TAG AGC CAC CAA TCC ACA CA
  1. Collagen-1 encodes type I collagen, integrin-β1 encodes integrin-β1, and FAK encodes focal adhesion kinase.