Skip to main content

Table 1 Sequences of used oligonucleotide primers

From: Diclofenac and triamcinolone acetonide impair tenocytic differentiation and promote adipocytic differentiation of mesenchymal stem cells

Primer sequence
Targets Forward primer Reverse primer
Collagen 1α1 gagcggagagtactggatcg gcttcttttccttggggttc
Tenomodulin tgtactggatcaatcccactct gctcattctggtcaactcccct
aP2 catggccaagcccaacat cgcccagtttgaaggaaatc
Osteocalcin gccatcaccctgtctcctaaa gctgtggagaagacacagca
Runx2 gccgggaatgatgagaacta ggtgaaactcttgcctcgtc